Categorías
De todo un poco El mundo a mis pies Musica

Olé!

feria-009-custom.jpg

Ya tenia yo la intención desde hace algunos años… pasearme con un traje de lunares por la Feria de Sevilla…

Entre excesos, bailes, caballos, luces y alboroto, con mi flor en la cabeza, el rojo como bandera, y la mirada profunda, mis tacones resonaron a cada paso. Buena compañía, melacolía del paso del tiempo aparcada entre las risas, el corazón abrigado, esperando que las castañuelas le alegren la mirada, y las vueltas, los giros, la noche, las ganas.

Y entre la resaca emocional, resuenan los primeros acordes de unas sevillanas….

feria-023-b-custom.jpg
A mis gatos les gustan mis lunares… 🙂


7 respuestas a «Olé!»

tiquitiquitiquitiquituiquitiquitiquití
tacatacatacatacatacatacatacatacatá
(es un zapateo, no se me ha ido la olla, ni es dialecto de Ganímedes)

Viva tu pare, Viva tu mare, eze arte, gitana, arsa… Oooooooooooolé

Me tocó la primer 🙂

Quiero quiero quiero!!!!

Ni idea que existía algo llamado la Feria de Sevilla, pero ahora que sé… que ganas de ver y llenarme los ojos de colores y esa gente bailando, y esa música!!!

Olé, que la vida siempre nos da lo que necesitamos cuando estamos listos pa’ recibirlo.
Olé!!!!

Raras las paradojas, yo viviendo aquí en Sevilla no he ido a bailar sevillas…

Empero, espero que te lo hayas pasado mejor que muy bien y hayas disfrutado de este buena fiesta¡Y que te hubieras “jartao” a rebujito!

Saludetes.

Deja una respuesta

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *